10 × nebuffer 3 1 (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs 10 × nebuffer 3 1
10 × Nebuffer 3 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1181 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/10%C3%97nebuffer+3+1/NEBuffer+3/pmc12596206-79-0-1
Average 97 stars, based on 1181 article reviews

10 × nebuffer 3 1 - by Bioz Stars, 2026-09

97/100 stars

Images

Clone Assay:

Article Title: Generation of cell-type-specific gene mutations by expressing the sgRNA of the CRISPR system from the RNA polymerase II promoters
Article Snippet: .. We cloned the DsRed sequence (693 bp) with primers DsRed-F and DsRed-R from DsRed2-C1 vector with BsmBI sites (Fig. S1B), chemical synthesized miR30-F-shRNA1, sgRNA targeting p53 gene (sgp53) [14], and shRNA2-miR30-R sequences (Supplementary Material, and the shRNA targeted sequences, ACAAGCTGGAGTACAACTACA and AAGATCCGCCACAACATCGAG are designed according to EGFP sequence) with BsmBI sites by BGI Company, and performed Golden Gate cloning (1 μL BsmBI (NEB), 1 μL 10×NEBuffer 3.1 (NEB), 1 μL T7 ligase (3,000U/μL, NEB), 1 μL ATP (10mM, NEB), 1μL for each DNA fragment and 1 μL distilled water, total 10μL) in a thermocycler using the cycling conditions: 37 oC for 5 minutes, 25 oC for 5 minutes, for 30 cycles [17] (Fig. S1C). ..

Sequencing:

Synthesized:

shRNA:

Cloning:

other:

Article Title: Construction and validation of co-expression vector for rice alpha tubulin and microtubule associated protein respectively fused with fluorescent proteins
Article Snippet: RNeasy Plant Mini Kit (cat. no. 74904; Qiagen, Hilden, Germany): extract total RNA from rice young inflorescence; SuperScript ® III First-Strand Synthesis System for RT-PCR (reverse transcription-polymerase chain reaction; cat. no. 18080-051; Invitrogen, Waltham, MA, USA): Synthesize first-strand cDNA from total RNA; High-fidelity polymerase: KOD-Plus-Neo polymerase and mating reagents including 10×PCR buffer, 25 mM MgSO 4 , and 2 mM dNTPs (cat. no. KOD-401; Toyobo, Osaka, Japan) were used in the PCR to amplify α-tubulin and MAPs ORFs from cDNA, and GFP , mCherry , 35S promoter, and NOS terminators from relevant plasmids; Taq DNA polymerase: 2×Taq MasterMix (Dye) (cat. no. CW0682; CWBio, Jiangsu, China) was used in the colony PCR; Restriction endonuclease: BglII (cat. no. R0144; NEB, Ipswich, MA, USA) supplied with 10×NEBuffer 3.1 (cat. no. B7203; NEB, Ipswich, MA, USA); KpnI-HF (cat. no. R3142; NEB, Ipswich, MA, USA), AscI (cat. no. R0558; NEB, Ipswich, MA, USA), both supplied with 10×CutSmart buffer (cat. no. B7204; NEB, Ipswich, MA, USA); Agarose (cat. no. e1714; BioWest, Bradenton, FL, USA): used for the analysis of nucleic acids by gel electrophoresis; SYBR ® Green I (cat. no. S7585; Sigma, Burlington, MA, USA): used for DNA stain in nucleic acid gel electrophoresis assay; 6×Gel loading dye (purple) (cat. no. B7025S; NEB, Ipswich, MA, USA): used for loading DNA samples on agarose during electrophoresis; DNA marker: 1 kb DNA Ladder (cat. no. N3232S; NEB, Ipswich, MA, USA), and 100 bp DNA Ladder (cat. no. N3231S; NEB, Ipswich, MA, USA); used to mark the size of DNA fragments; 50×TAE (tris base + acetic acid + EDTA) buffer (cat. no. B49; Thermo Fisher Scientific, Waltham, MA, USA): a buffer used for nucleic acid gel electrophoresis; dilute it to 1× in water before use; Monarch ® DNA Gel Extraction Kit (cat. no. T1020; NEB, Ipswich, MA, USA): Purify DNA fragments and linear plasmids from an agarose gel; Monarch ® Plasmid Miniprep Kit (cat. no. T1010; NEB, Ipswich, MA, USA): Purify plasmids from E. coli culture medium; NEBuilder ® HiFi DNA Assembly Master Mix (cat. no. E2621; NEB, Ipswich, MA, USA): Assemble DNA fragments in seamless cloning assay; LB (Luria-Bertani) medium: 1% tryptone (cat. no. LP0042B; Oxoid, Hampshire, England), 0.5% yeast extract (cat. no. LP0021; Oxoid, Hampshire, England), 1% NaCl (cat. no. S3014; Sigma, Burlington, MA, USA); add 1.5% agar (cat. no. 70101ES76; Yeasen, Shanghai, China) to obtain the solid medium; before usage it is sterilized at 121 °C for 20 min.

Review